Injection:Article Title: The mevalonate pathway contributes to breast primary tumorigenesis and lung metastasis
Article Snippet: To measure the extravasation of breast cancer cells, the indicated cell lines were labeled with 5 μ m of a cell tracker (CellTracker Green carboxymethyl fluorescein diacetate; Cat. No. C2925; Invitrogen) for 1 h and then intravenously injected into mice (1 × 10 6 cells per mouse). .. After 48 h, the mice were injected intravenously with a rhodamine‐conjugated lectin (Cat. No. RL‐1002‐25; Vector Laboratories, Newark, CA, USA) to stain lung capillaries and animals were sacrificed 1 h later. .. Lungs were then extracted, fixed in paraformaldehyde (Cat. No. 252931; PanReac), and examined by confocal fluorescence microscopy to determine the number of cancer cells (those exhibiting green fluorescence) present in the lung parenchyma (six confocal sections per tumor).
Staining:Article Title: The mevalonate pathway contributes to breast primary tumorigenesis and lung metastasis
Article Snippet: To measure the extravasation of breast cancer cells, the indicated cell lines were labeled with 5 μ m of a cell tracker (CellTracker Green carboxymethyl fluorescein diacetate; Cat. No. C2925; Invitrogen) for 1 h and then intravenously injected into mice (1 × 10 6 cells per mouse). .. After 48 h, the mice were injected intravenously with a rhodamine‐conjugated lectin (Cat. No. RL‐1002‐25; Vector Laboratories, Newark, CA, USA) to stain lung capillaries and animals were sacrificed 1 h later. .. Lungs were then extracted, fixed in paraformaldehyde (Cat. No. 252931; PanReac), and examined by confocal fluorescence microscopy to determine the number of cancer cells (those exhibiting green fluorescence) present in the lung parenchyma (six confocal sections per tumor).
Article Title: The reticulon protein, TtRET1, is required for the initiation of mating in Tetrahymena thermophila
Article Snippet: .. For Concanavalin (ConA-Rhodamine (Vector Laboratories) staining, 1ml of mating culture was extracted (at 15, 30, 60 minutes and 3 hours) then incubated with 50ug/ml of ConA-Rhodamine for five minutes at 30 o C. This was subsequently centrifuged then washed with 10mM Tris three times. .. ConA-Rhodamine treated mating reactions were then immobilized using NiCl and imaged immediately using Zeiss Axio Observer with Apotome.
Article Title: Cardamonin intervenes in myocardial hypertrophy progression by regulating Usp18.
Article Snippet: The sections were stained with H&E stain kits (Solarbio, G1120) and Masson kit (Solarbio, G1340) Z. Feng et al. Phytomedicine 134 (2024) 155970 following the manufacturer’s instructions. .. Wheat germ agglutinin (WGA) staining To determine the cross-sectional area of cardiomyocytes, paraffin heart sections were soaked in a WGA solution (2 ng/ml, VECTOR, RL1002), left to incubate at room temperature for 1 hour, and then rinsed three times with PBS. ..
Incubation:Article Title: Cryo-electron tomography reveals lineage-specific replication features of Zika virus
Article Snippet: ZIKV was detected using a 1:100 dilution of the primary antibody ZKA64 (AG-27B-6004PF, AdipoGen, Lausanne, Switzerland) for 1 hour. .. Cells were then washed with PBS and incubated with an anti-human IgG-A488 secondary antibody (A10631, Life Technologies) and rhodamine-conjugated concanavalin A (RL-1002, Vector Laboratories, California, USA) for 30 minutes. .. Afterward, cells were washed with distilled water (ddH 2 O) and mounted on glass slides using DAPI mounting medium (P36941, Life Technologies).
Article Title: The porcine carotid body: morphological and lectin histochemical characterization
Article Snippet: .. For lectin histochemistry, the slides containing the bifurcation of the common carotid artery (CCA) were routinely processed and incubated at room temperature for 60 min with Concanavalin A (Con A; Vector Laboratories, Rhodamine Lectin Kit, RLK-2200) and Sambucus nigra agglutinin (SNA; Vector Laboratories, Rhodamine Lectin Kit, RLK-2200). ..
Article Title: The reticulon protein, TtRET1, is required for the initiation of mating in Tetrahymena thermophila
Article Snippet: .. For Concanavalin (ConA-Rhodamine (Vector Laboratories) staining, 1ml of mating culture was extracted (at 15, 30, 60 minutes and 3 hours) then incubated with 50ug/ml of ConA-Rhodamine for five minutes at 30 o C. This was subsequently centrifuged then washed with 10mM Tris three times. .. ConA-Rhodamine treated mating reactions were then immobilized using NiCl and imaged immediately using Zeiss Axio Observer with Apotome.
Recombinant:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
Blocking Assay:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
RNAscope:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
Multiplex Assay:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
dsDNA Assay:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
Cell Culture:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
Single Cell:Article Title: Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NeuN Antibody Sigma-Aldrich RRID: AB_2298772 Goat Anti-Mouse IgG Vector Lab RRID: AB_2336171 Biological samples #1 Cynomolgus monkeys (6-year-old, male) This study N/A #2 Cynomolgus monkeys (4-year-old, male) This study N/A #3 Cynomolgus monkeys (4-year-old, male) This study N/A #4 Cynomolgus monkeys (4-year-old, male) This study N/A #5 Cynomolgus monkeys (12-year-old, female) This study N/A #6 Cynomolgus monkeys (7-year-old, male) This study N/A #7 Cynomolgus monkeys (3-year-old, female) This study N/A #1 Common marmosets (5-year-old, male) This study N/A #2 Common marmosets (2-year-old, male) This study N/A #3 Common marmosets (2-year-old, male) This study N/A 18 Mouse (11-week-old) This study N/A Chemicals, peptides, and recombinant proteins Normal Goat Serum Blocking Solution Vector Lab S-1000-20 VECTASTAIN ABC-HRP Kit Vector Lab PK-4000 RNAscope Wash Buffer Reagents Advanced Cell Diagnostic Cat.No.310091 RNAscope Target Retrieval Reagents Advanced Cell Diagnostic Cat.No.322000 RNAscope H2O2 and Protease Reagents Advanced Cell Diagnostic Cat.No.322381 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostic Cat.No.323110 RNAscope Multiplex TSA Buffer Advanced Cell Diagnostic Cat.No.322810 550/570 nm Opal 570 Reagent Pack Akoya FP1488001KT TSA Vivid Fluorophore 650 Advanced Cell Diagnostic Cat.No.323273 DAPI Fluromount-G SouthernBiotech Cat.No.0100-20 Probe Diluent Advanced Cell Diagnostic Cat.No.300041 20 3 PBS Buffer Sangon Biotech B548117-0500 Paraformaldehyde Sigma-Aldrich P6148-1KG Tissue-Tek OCT Sakura 4583 AMPure XP Beads Vazyme N411-03 ssDNA reagent lnvitroge Q10212 20 3 SSC Ambion AM9770 Pepsin Sigma P7000 RNase inhibitor NEB M0314L Exonuclease I NEB M0293L Qubit dsDNA Assay Kit INVITROGEN Q32854 EDTA INVITROGEN 15575-038 ConA Rhodamine Vector RL-1002 Cell culture dishes Shanghai Titan Scientific Co., Ltd 02055006 Methanol Sigma-Aldrich 34860-1L-R (Continued on next page) ll OPEN ACCESS e1 Cell 188, 1–19.e1–e11, July 10, 2025 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Public Single-nucleus RNA sequencing data of human hippocampus NCBI GEO GEO: GSE160189 Public Single-nucleus RNA sequencing data of macaque cortex Macaque Spatial Transcriptome Atlas snRNA-seq data: https://macaque.digitalbrain.cn/spatial-omics/singleCellData? project=neocortex FASTQ for snRNA-seq data This study CNGB database: https://db.cngb.org/search/ project/CNP0005571 Processed data of Stereo-seq and snRNA-seq data This study Processed matrix: https://doi.org/10.12412/ BSDC.1714460320.30001 Oligonucleotides RNAscope Probe- Mfa-TSHZ2-C1 Advanced Cell Diagnostic 1229081-C1 RNAscope Probe- Mfa-CPLX3-C2 Advanced Cell Diagnostic 1314051-C1 RNAscope Probe-Mfa-TTN-C3 Advanced Cell Diagnostic 1314011-C3 RNAscope Probe - Mmu-SST Advanced Cell Diagnostic 461681 Stereo-seq-TSO: CTGCTGACGTAC TGAGAGGC/rG/rG/iXNA_G/ Sangon N/A cDNA PCR primer: CTGCTGACGT ACTGAGAGGC Sangon N/A Stereo-seq-library-F: /5phos/CTGCT GACGTACTGAGAGG*C*A Sangon N/A Stereo-seq-library-R: GAGACGTTCT CGACTCAGCAGA Sangon N/A Stereo-seq-library-splint-oligo: GTACG TCAGCAGGAGACGTTCTCG Sangon N/A Stereo-seq-read1: CTGCTGACGTACT GAGAGGCATGGCGACCTTATCAG Sangon N/A Stereo-seq-MDA-primer: TCTGCTGA GTCGAGAACGTC Sangon N/A Stereo-seq-read2: GCCATGTCGTTCT GTGAGCCAAGGAGTT Sangon N/A Software and algorithms python https://www.python.org/ 3.7.13 anndata https://anaconda.org/anaconda/anndata 0.8.0 pandas https://anaconda.org/anaconda/pandas 1.3.5 scipy https://anaconda.org/anaconda/scipy 1.7.3 numpy https://anaconda.org/anaconda/numpy 1.21.5 scikit-learn https://anaconda.org/anaconda/scikit-learn 1.0.2 seaborn https://anaconda.org/anaconda/scikit-learn 0.12.0 scanpy https://pypi.org/project/scanpy/ 1.9.1 matplotlib https://anaconda.org/conda-forge/matplotlib 3.5.3 Metascape https://metascape.org/ SynGO https://www.syngoportal.org/ harmonypy https://pypi.org/project/harmonypy/ 0.0.9 R https://cran.r-project.org/mirrors.html 4.1.3 MetaNeighbor https://github.com/gillislab/MetaNeighbor V1.13.0 pySCENIC https://github.com/aertslab/pySCENIC 0.12.1 Seurat https://satijalab.org/seurat/ V4.1.1 pyvista https://github.com/pyvista/pyvista 0.41.1 nibabel https://github.com/nipy/nibabel 5.2.0 pyacvd https://github.com/pyvista/pyacvd 0.2.9 (Continued on next page) ll OPEN ACCESS Cell 188, 1–19.e1–e11, July 10, 2025 e2 Please cite this article in press as: Lei et al., Single-cell spatial transcriptome atlas and whole-brain connectivity of the macaque claustrum, Cell (2025), https://doi.org/10.1016/j.cell.2025.02.037 Article
Whole Genome Amplification:Article Title: Cardamonin intervenes in myocardial hypertrophy progression by regulating Usp18.
Article Snippet: The sections were stained with H&E stain kits (Solarbio, G1120) and Masson kit (Solarbio, G1340) Z. Feng et al. Phytomedicine 134 (2024) 155970 following the manufacturer’s instructions. .. Wheat germ agglutinin (WGA) staining To determine the cross-sectional area of cardiomyocytes, paraffin heart sections were soaked in a WGA solution (2 ng/ml, VECTOR, RL1002), left to incubate at room temperature for 1 hour, and then rinsed three times with PBS. ..
|
Vector Laboratories is a verified supplier 
Vector Laboratories manufactures this product 
